View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_high_4 (Length: 531)
Name: NF6157_high_4
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 7e-75; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 7e-75
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 32165728 - 32165524
Alignment:
| Q |
18 |
gttatagggtagccttgtggtggcggatacggagtcccgtatggcggagggtatgggtcttgcggtgctctctggtagtcgctcatttttgttggattag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165728 |
gttatagggtagccttgtggtggcggatacggagtcccgtatggcggagggtatgggtcttgcggtgctctctggtagtcgctcatttttgttggattag |
32165629 |
T |
|
| Q |
118 |
ggattc-----agggaagggaagacctgtgtgggtacctcttcttgcctttctgtctatatgggtcgaa--ggatagg-tataagaaaatgaaagccaaa |
209 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| | | ||| ||| |||||||||||||||| |||| |
|
|
| T |
32165628 |
ggattcaaggaagggaagggaagacctgtgt-ggtacctcttcttgcctttctgtctatatgggttggattggagaggatataagaaaatgaaaggcaaa |
32165530 |
T |
|
| Q |
210 |
attaca |
215 |
Q |
| |
|
|||||| |
|
|
| T |
32165529 |
attaca |
32165524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 463 - 527
Target Start/End: Complemental strand, 32164674 - 32164610
Alignment:
| Q |
463 |
tttcatccagtcgccatgaggacgacatcatccaatttcaccgataaaattgatatcatctgtga |
527 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
32164674 |
tttcatccagtcgccatgaggacgacgtcatccaatttcaccaataaaattgatgtcatctgtga |
32164610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 382
Target Start/End: Complemental strand, 32164753 - 32164700
Alignment:
| Q |
329 |
ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcatgtgat |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32164753 |
ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcacgtgat |
32164700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University