View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_high_45 (Length: 231)
Name: NF6157_high_45
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 14560025 - 14560239
Alignment:
| Q |
1 |
aaaccaatccctcaatcacaattggttatagaatataatcatgaatttaacagaatgtcgtctaatgttaagttctcacgatcaagttattcttatcctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
14560025 |
aaaccaatccctcaatcacaattggttatagaatataatcatgaatttaacagaatgtcgtctaatgttaagttctcacgatcaaggtattttgatcctg |
14560124 |
T |
|
| Q |
101 |
gagcaagtacttcaactaatcctcatactggactcttaagtgagataagaactgcagatgtttgtgatttatcaaccgcgccaaattaggaaaatgctaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14560125 |
gagcaagtacttcaactaatcctcatactggactcttaagtgagataagaactgcagatgtttgtgatttatcaaccgcgccaaattaggaaaatgctaa |
14560224 |
T |
|
| Q |
201 |
gagaaagcaacactt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14560225 |
gagaaagcaacactt |
14560239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University