View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_11 (Length: 414)
Name: NF6157_low_11
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 1e-94; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 21265898 - 21265703
Alignment:
| Q |
19 |
acaatagcatcacattgtccttcaaaatcctcattaaagcacgtaagcaattagtctcttgtagattttaaaggttatcccagtttctaagcctggtacc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21265898 |
acaatagcatcacattgtccttcaaaatcctcattaaagcacgtaagcacctagtctcttgtagattttaaaggttatcccagtttctaagcctggtacc |
21265799 |
T |
 |
| Q |
119 |
cgtgatgatactagatgctgggcagcttctaccatccttagacggaattatagtgagttaaaaatgtacatgtccactacaaatatactagaataa |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21265798 |
cgtgatgatactagatgttgggcagcttctaccatccttagagggaattatagtgagttaaaaatgtgcatgtccactacaaatatactagaataa |
21265703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 213 - 288
Target Start/End: Complemental strand, 21265679 - 21265604
Alignment:
| Q |
213 |
aacaaggtacgtatctctgtgcgtaacttcgaggctaatctctaaaaccatgttatatcctgttctaccacaatgg |
288 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
21265679 |
aacaaggtacgtatctctgtgcctaacttcgaggctaatctctaaaaccatgttatgtactgttctaccacaatgg |
21265604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 314 - 404
Target Start/End: Complemental strand, 21265148 - 21265058
Alignment:
| Q |
314 |
tagaatcaaagataaagaaatttgctcccacgcgacgcgcgggtcttattctagttttatttataaatccaattattgaattaatgtacct |
404 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| || ||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21265148 |
tagaatgaaagataaagaaatttgctcccccgcaacacgcgggttctattatagttttatttataaatccaattattgaattaatgtacct |
21265058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 303 - 375
Target Start/End: Original strand, 42260274 - 42260346
Alignment:
| Q |
303 |
tcacatgataatagaatcaaagataaagaaatttgctcccacgcgacgcgcgggtcttattctagttttattt |
375 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| | ||| ||| ||||||| | ||||||||| |||| |
|
|
| T |
42260274 |
tcacataataatagaatcaaagatcaagaaatttgctcacgcgcaacgtgcgggtcctgttctagtttaattt |
42260346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University