View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_21 (Length: 358)
Name: NF6157_low_21
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 144 - 338
Target Start/End: Original strand, 39776856 - 39777049
Alignment:
| Q |
144 |
taactaacatgttttctaatttgctttgctcttcaaataccaacaatactaatgattatttattattttcacattgtttcctactcgaacgacatttagt |
243 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39776856 |
taactaacatgttt-ctaatttgctttgctcttcaaataccaacaatactaatgattatttattattttcacattgtttcctactcgaacgacatttagt |
39776954 |
T |
 |
| Q |
244 |
ttcaccttgttttcataacataaaatttacagcatccacgccgccgctagtgaggccgttgtcgtttttctgtgatgaattaagtgtgttggata |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39776955 |
ttcaccttgttttcataacataaaatttacagcatccacgctgccgctagtgaggccgctgtcgtttttctgtgatgaattaaatgtgttggata |
39777049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 118
Target Start/End: Original strand, 39776826 - 39776869
Alignment:
| Q |
75 |
gtgttgtcatttctcaatctctgaatttaattactaacatgttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39776826 |
gtgttgtcatttctcaatctctgaatttaataactaacatgttt |
39776869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University