View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_24 (Length: 330)
Name: NF6157_low_24
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 5 - 285
Target Start/End: Original strand, 32333104 - 32333381
Alignment:
| Q |
5 |
gccggaagtggtgggaactgcgtaccttgaagcagcggcaatcatttttcgtgagggaatattggagaaagagatgcttgctctgaggttcattcattca |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
32333104 |
gccggaagtggtgggaacggcgtaccttgaagcagcggcaatcatttttcttcagggaatattggagaaagagatgctttctctgaggttcactcattca |
32333203 |
T |
 |
| Q |
105 |
ttttgctgctccagcggagttttacatgtgcttgtgattattttatcattattattcaagtcaatgcattcactcaccccacaacatgacacacatgtat |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32333204 |
ttttgctgctacagcggagttttacatgtgcttgtcattattttatc---attattcaagtcaatgcattcactcaccccacaacatgacacacatgtat |
32333300 |
T |
 |
| Q |
205 |
ccatttcaaacaccacacaaacttccctctttcaaacaagataactatttcgtctaacttcattcaacgttaacttcaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32333301 |
ccatttcaaacaccacacaaacttctctctttcaaacaagataactatttcctctaacttcattcaacgttaacttcaaaa |
32333381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University