View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_30 (Length: 296)
Name: NF6157_low_30
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 281
Target Start/End: Original strand, 30842544 - 30842819
Alignment:
| Q |
9 |
gagaagaagggttcaaagttagcattatttaccaaggatgacagttatttggtgaataataaggctatgtctacattcaagtttaatactgatgcttatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842544 |
gagaagaagggttcaaagttagcattatttactaaggatgacagttatttggtgaataataaggctatgtctacattcaagtttaatactgatgcttatg |
30842643 |
T |
|
| Q |
109 |
caattggacacaggttatcatccaaaccaagtatagtggataactcctcgatgaaacatgcatccacttcaggtaaatcaattcaattatattggtagaa |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30842644 |
caattggacacaagttatcatccaaaccaagtatagtggataactcctcgatgaaacatgcatccacttcaggtaaatcaattcaattatattggtagaa |
30842743 |
T |
|
| Q |
209 |
aaattgctgacaaatatttgccatgacatata---ttgttgtgattaaatttgttgaagttgagaatgtctatttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
30842744 |
aaattgctgacaaatatttgccatgacatatattgttgttgtgaataaatttgttgaagttgagaatctctatttt |
30842819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University