View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_36 (Length: 256)
Name: NF6157_low_36
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 240
Target Start/End: Complemental strand, 10055026 - 10054801
Alignment:
| Q |
15 |
atgaaaacaacagctgcaaacactgttattacaaaggaaaataagccacttattttcagcttctccttcttaggtgcaaacactatgaaaatgaaaacat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10055026 |
atgaaaacaacagctgcaaacactgttattacaaaggcaaataagccacttattttcagcttctccttcttaggtgcaaacactatgaaaatgaaaacat |
10054927 |
T |
|
| Q |
115 |
atatgatttcaataactgctcctgttccatttatgattgttactagtatgttgtctggtgacacaaatggtaaaccatacctgaaaattgttacatatac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10054926 |
atatgatttcaataactgctcctgttccatttatgattgttacaagtatgttgtctggtgacacaaatggtaaaccatacctgaaaattgttacatatac |
10054827 |
T |
|
| Q |
215 |
acaaatcagaacatgatctataagtt |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10054826 |
acaaatcagaacatgatctataagtt |
10054801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 78 - 181
Target Start/End: Original strand, 40832989 - 40833092
Alignment:
| Q |
78 |
tccttcttaggtgcaaacactatgaaaatgaaaacatatatgatttcaataactgctcctgttccatttatgattgttactagtatgttgtctggtgaca |
177 |
Q |
| |
|
||||||||||||||||| | ||||| || |||||||||||||||||||| ||||||| || ||||||| ||||||| ||||||||| || |||| |
|
|
| T |
40832989 |
tccttcttaggtgcaaatatgatgaatatcaaaacatatatgatttcaatccctgctccggtgccatttactgttgttaccggtatgttgttgggagaca |
40833088 |
T |
|
| Q |
178 |
caaa |
181 |
Q |
| |
|
|||| |
|
|
| T |
40833089 |
caaa |
40833092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University