View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_39 (Length: 250)
Name: NF6157_low_39
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 6 - 245
Target Start/End: Original strand, 31667569 - 31667809
Alignment:
| Q |
6 |
aaagtgacatgttagtgcttttctaataggtacatagcgttttgaatatct-attttgctatttggttcggatttagagttgttttgttggtgtacaagt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31667569 |
aaagtgacatgttagtgcttttctaataggtacatagcgttttgaatatcttattttgctatttggttcggatttagagttgttttgttggtgtacaagt |
31667668 |
T |
|
| Q |
105 |
gtgctaagtgtttcagttttcaaacagcatttagttttacattaattccatttctcacatttgtatgtctatatctcaactagaaaaacttttccaggtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31667669 |
gtgctaagtgtttcagttttcaaacagcatttagctttacattaattccatttctcacatttgtatgtctatatctcaactagaaaaacttttccaggtt |
31667768 |
T |
|
| Q |
205 |
gcagagtacattttctgctaactttgatgattcttctcact |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31667769 |
gcagagtacattttctgctaactttgatgattcttttcact |
31667809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University