View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_42 (Length: 241)
Name: NF6157_low_42
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 45845084 - 45845309
Alignment:
| Q |
1 |
ttaatcaaagttagacccgtgactgtttatcttaataatctgagtcagcaaatgattaagaagaatcttccttaatttcagctttaagtaacttctcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45845084 |
ttaatcaaagttagacccgtgactgtttatcttaataatctgagtcagcaaatgattaagaagaatcttccttaatttcagctttaagtaacttctcttc |
45845183 |
T |
 |
| Q |
101 |
atcaacttctttgctgtcatcaataaaaacatcacttgtttttgttgcttctccaattccagttaatttcttagctcttagtgcttcacaatcccaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45845184 |
atcaacttctttgctgtcatcaataaaaacatcacttgtttttgttgcttctccaattccagttaatttcttagctcttagtgcttcacaatcccaatct |
45845283 |
T |
 |
| Q |
201 |
gtttgactcaaaacaaccaacatagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45845284 |
gtttgactcaaaacaaccaacatagt |
45845309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University