View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6157_low_43 (Length: 240)
Name: NF6157_low_43
Description: NF6157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6157_low_43 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 102 - 240
Target Start/End: Complemental strand, 6133548 - 6133408
Alignment:
| Q |
102 |
atggtgttgattctgagtgtgagttggtgtttgtaagagtc-aaagactagcgtttt-gtggggagaagctattgttggttagcaatatataattatata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6133548 |
atggtgttgattctgagtgtgagttggtgtttgtaagagtttaaagactagtgtttttgtggggagaagctattgttggttagcaatatataattatata |
6133449 |
T |
|
| Q |
200 |
ttactatgatgcgtgtttcataaggtattaattaatcacgc |
240 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6133448 |
tttctatgatgcgtgcttcataaggtattaattaatcacgc |
6133408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 209
Target Start/End: Complemental strand, 20599799 - 20599735
Alignment:
| Q |
144 |
aagactagcgttttgtggggagaagctattgttggttagcaatatataattatatattactatgat |
209 |
Q |
| |
|
|||| ||||||| ||||||||||||| |||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
20599799 |
aagagtagcgttatgtggggagaagcaattgttgg-tagcaatatataaatatatagtactatgat |
20599735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University