View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6159_high_10 (Length: 254)
Name: NF6159_high_10
Description: NF6159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6159_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 25 - 149
Target Start/End: Original strand, 10048632 - 10048759
Alignment:
| Q |
25 |
aaagggaaataattggtggagacaaagcc---tgcaaactagatttcattaatgtatggtccatgtgaggagatcatatctttctgaagttgtacagaag |
121 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10048632 |
aaagggaaataattggtggacacaaagccgcctgcaaactagatttcattaatgtatggtccatgtgaggggatcatatctttctgaagttgtacagaag |
10048731 |
T |
 |
| Q |
122 |
gaattaaacaagacttagtttggttccc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10048732 |
gaattaaacaagacttagtttggttccc |
10048759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University