View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6159_high_14 (Length: 205)
Name: NF6159_high_14
Description: NF6159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6159_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 2 - 195
Target Start/End: Original strand, 54504983 - 54505173
Alignment:
| Q |
2 |
gtcaaagtcgccttcagtaccctcagagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggccccgtcatcttcaccttcagacgag |
101 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54504983 |
gtcaaagtcgccttca---ccctccgagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggcaccgtcatcttcaccttcagacgag |
54505079 |
T |
 |
| Q |
102 |
tcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54505080 |
tcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt |
54505173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University