View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6159_high_14 (Length: 205)

Name: NF6159_high_14
Description: NF6159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6159_high_14
NF6159_high_14
[»] chr4 (1 HSPs)
chr4 (2-195)||(54504983-54505173)


Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 2 - 195
Target Start/End: Original strand, 54504983 - 54505173
Alignment:
2 gtcaaagtcgccttcagtaccctcagagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggccccgtcatcttcaccttcagacgag 101  Q
    ||||||||||||||||   ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
54504983 gtcaaagtcgccttca---ccctccgagtcaccatcactggcaccgtcaccttcagattcagtagcttcattggcaccgtcatcttcaccttcagacgag 54505079  T
102 tcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54505080 tcaccttcaccggcaccgtccccaagttcatctggtagtaaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt 54505173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University