View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6159_low_14 (Length: 248)
Name: NF6159_low_14
Description: NF6159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6159_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 10048322 - 10048138
Alignment:
| Q |
1 |
gtgatgcaagctgtgtgcctcctccaactgtacccacctgcattattnnnnnnntattacataaataaatcatacataaaatagtgccatagtggtgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10048322 |
gtgatgcaagctgtgtgcctcctccaactgtacccacctgcattattaaaaaaatattacataaataaatcatacatagaatagtgccatagtggtgttg |
10048223 |
T |
|
| Q |
101 |
tcatgtcaaatttatatca-------aaatnnnnnnntattactgctagaatagcacttgaggtagttgtgaaaatattcaccta |
178 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10048222 |
tcatgtcaaatttatatcaaaataaaaaataaaaaaacattactgctagaatagcacttgaggtagttgtgaaaatattcaccta |
10048138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 167 - 232
Target Start/End: Complemental strand, 10048096 - 10048031
Alignment:
| Q |
167 |
aatattcacctacactacacgtatgctgcctgtagagtaacatgggacctaaaacatggatgtgat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10048096 |
aatattcacctacactacacgtatgctgcctgtagagtaacatgggacctaaaacatgcatgtgat |
10048031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 47
Target Start/End: Complemental strand, 39677366 - 39677322
Alignment:
| Q |
3 |
gatgcaagctgtgtgcctcctccaactgtacccacctgcattatt |
47 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
39677366 |
gatgcaagttgtgtaccccctccaactgtacccacctgcattatt |
39677322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University