View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6161_high_19 (Length: 268)
Name: NF6161_high_19
Description: NF6161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6161_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 100 - 157
Target Start/End: Original strand, 19964390 - 19964447
Alignment:
| Q |
100 |
atgagtgttcttattgtagtccttgaatgtatcagtattgcaaattcatacccaagtg |
157 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19964390 |
atgagtgttcttattatagtcattgaatgtatcaatattgcaaattcatacccaagtg |
19964447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 99 - 161
Target Start/End: Complemental strand, 19909687 - 19909623
Alignment:
| Q |
99 |
tatgagtgttcttattgta--gtccttgaatgtatcagtattgcaaattcatacccaagtgtctc |
161 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19909687 |
tatgagtgttcttattatatagtccttgaatgtatcggtattgcaaattcatacccaagtgtctc |
19909623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University