View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6161_high_20 (Length: 267)
Name: NF6161_high_20
Description: NF6161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6161_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 26755483 - 26755737
Alignment:
| Q |
1 |
ggacacagaaattcaccaaaggaaccaaattccctcaactgatgtgcccgaagagatcaccattatttttccggaccagctattactggaggaagatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26755483 |
ggacacagaaattcaccaaaggaaccaaattccctcaactgatgtgcctgaagagatcaccattatttttccggaccagctattactggaggaagatcaa |
26755582 |
T |
 |
| Q |
101 |
gttgctgctactatgttccagactaaaagctgcataggtggtgaagagcgaaacacaagcaataagtggcaatggccaactatgaacaagagacctatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26755583 |
tttgctgctactatgttccagactaaaagctgcataggtggtgaagagcgaaacacaagcaataagtggcaatggccaactatgaacaagagacctatgc |
26755682 |
T |
 |
| Q |
201 |
aagatgttgaggaaatgagaaagattaacccaagaaagccaaatttcctgccctt |
255 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26755683 |
aagatgttgaggaaatgagaaagatcaacccaagaaagccaaatttcctgccctt |
26755737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University