View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6161_high_4 (Length: 445)
Name: NF6161_high_4
Description: NF6161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6161_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 58 - 127
Target Start/End: Complemental strand, 3672941 - 3672872
Alignment:
| Q |
58 |
acacccattttttaattagatgaaagtcatgtgagtttgacattttgaaaataatctctcgcaccaattt |
127 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
3672941 |
acacccatttttcaattaaatgaaagtcatgtgagtttgacattttaaaaataatcttttgcaccaattt |
3672872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 3672550 - 3672510
Alignment:
| Q |
196 |
aatgtaagtaacagtttagacaaaaatgattctactcaaaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3672550 |
aatgtaagtaacagtttagacaaaaatgattctacccaaaa |
3672510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University