View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6161_high_4 (Length: 445)

Name: NF6161_high_4
Description: NF6161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6161_high_4
NF6161_high_4
[»] chr1 (2 HSPs)
chr1 (58-127)||(3672872-3672941)
chr1 (196-236)||(3672510-3672550)


Alignment Details
Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 58 - 127
Target Start/End: Complemental strand, 3672941 - 3672872
Alignment:
58 acacccattttttaattagatgaaagtcatgtgagtttgacattttgaaaataatctctcgcaccaattt 127  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||| | ||||||||||    
3672941 acacccatttttcaattaaatgaaagtcatgtgagtttgacattttaaaaataatcttttgcaccaattt 3672872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 3672550 - 3672510
Alignment:
196 aatgtaagtaacagtttagacaaaaatgattctactcaaaa 236  Q
    ||||||||||||||||||||||||||||||||||| |||||    
3672550 aatgtaagtaacagtttagacaaaaatgattctacccaaaa 3672510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University