View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6161_low_21 (Length: 273)
Name: NF6161_low_21
Description: NF6161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6161_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 67 - 256
Target Start/End: Original strand, 25290732 - 25290921
Alignment:
| Q |
67 |
ttgatccaattcacattacctgagtaggacgcattgcggtttcaagcgcagaaagacgatgatcaaacgaaccaagaatcgaaaccatgttatcggtaat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290732 |
ttgatccaattcacattacctgagtaggacgcattgcggtttcaagcgcagaaagacgatgatcaaacgaaccaagaatcgaaaccatgttatcggtaat |
25290831 |
T |
|
| Q |
167 |
ggtttggcttttgtgaagcgagtctttaacgaacgttgctcgttcgtgtaaagcaaccatggcttgaggaattcccattgtgacgaattt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290832 |
ggtttggcttttgtgaagcgagtctttaacgaacgttgctcgttcgtgtaaagcaaccatggcttgaggaattcccattgtgacgaattt |
25290921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 40565086 - 40564986
Alignment:
| Q |
84 |
acctgagtaggacgcattgcggtttcaagcgcagaaagacgatgatcaaacgaaccaagaatcgaaaccatgttatcggtaatggtttggcttttgtgaa |
183 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||| || ||||| ||||||||||| | || | ||| || ||||| ||||||||||| |||| |
|
|
| T |
40565086 |
acctgagttggacgcatggcggtttcaagagcagaaagacggtggtcaaaggaaccaagaatggtgacaacgttgtctgtaattgtttggcttttttgaa |
40564987 |
T |
|
| Q |
184 |
g |
184 |
Q |
| |
|
| |
|
|
| T |
40564986 |
g |
40564986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University