View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6161_low_22 (Length: 268)

Name: NF6161_low_22
Description: NF6161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6161_low_22
NF6161_low_22
[»] chr8 (1 HSPs)
chr8 (100-157)||(19964390-19964447)
[»] chr4 (1 HSPs)
chr4 (99-161)||(19909623-19909687)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 100 - 157
Target Start/End: Original strand, 19964390 - 19964447
Alignment:
100 atgagtgttcttattgtagtccttgaatgtatcagtattgcaaattcatacccaagtg 157  Q
    ||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||||    
19964390 atgagtgttcttattatagtcattgaatgtatcaatattgcaaattcatacccaagtg 19964447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 99 - 161
Target Start/End: Complemental strand, 19909687 - 19909623
Alignment:
99 tatgagtgttcttattgta--gtccttgaatgtatcagtattgcaaattcatacccaagtgtctc 161  Q
    |||||||||||||||| ||  ||||||||||||||| ||||||||||||||||||||||||||||    
19909687 tatgagtgttcttattatatagtccttgaatgtatcggtattgcaaattcatacccaagtgtctc 19909623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University