View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6161_low_30 (Length: 235)
Name: NF6161_low_30
Description: NF6161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6161_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 38512936 - 38513161
Alignment:
| Q |
1 |
gtcgggggagtttgcagatagaccaagaagctctgtcaccacaccaatatttgtattagaaaaatgctaatgaatgccctaaagacatgtttatgtcgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
38512936 |
gtcgggggagtttgcagatagaccaagaagctctgtcaccacaccaatattcgtattagaaaaatgctaatgaatgtcctaaggacatgtttatgtcgtc |
38513035 |
T |
 |
| Q |
101 |
aacaactttgttatgaatgatagttttaaaggnnnnnnnntgctgtaaagaaaagttttaatcaactcaaaacacaa-----annnnnnnnaattaaccc |
195 |
Q |
| |
|
||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38513036 |
aacaactttgtcatcgatgatagttttaaaggaaaaaaaatgctgtaaagaaaagttttaatcaactcaaaacacaattttttttttaattaattaaccc |
38513135 |
T |
 |
| Q |
196 |
aaaacaagaaaaattgatggaatatt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38513136 |
aaaacaagaaaaattgatggaatatt |
38513161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University