View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6162_high_2 (Length: 339)
Name: NF6162_high_2
Description: NF6162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6162_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 323
Target Start/End: Complemental strand, 49880094 - 49879782
Alignment:
| Q |
11 |
gaacctgtgtttttctcatgaagtactcaacaacaagtatcccgccaaaacgagcagctacctctttactgttcatgacaagaggctcttccatttcatc |
110 |
Q |
| |
|
|||| |||| ||||| ||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
49880094 |
gaacttgtggttttcccatgaagtaatcaacaacaagtatcccgctaaaacgagcagctacctcattactattcatggcaagaggctcttccatttcatc |
49879995 |
T |
|
| Q |
111 |
attgggaacttgaaccacccaacgtccttgtcttgcaggaaataccctgttgttcttggcccttcttggtgctccatacaacttctctatcagatcaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49879994 |
attgggaacttgaaccacccaacgtccttgtcttgcaggaaataccctgttgttcttggcccttcttggtgctccatacaacttctctatcagatcaaac |
49879895 |
T |
|
| Q |
211 |
ccttccaaacctatctctctcaggtttgtttcagctgccattaattgatgttgaagttgaagttgagggaatagttattatgctttgtgtgtgttttctg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49879894 |
ccttccaaacctatctctctcaggtttgtttcaggtgccattaattgatgttgaagttgaagttgagggaatagttattatgctttgtgtgtgttttctg |
49879795 |
T |
|
| Q |
311 |
gttgcttcaatag |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49879794 |
gttgcttcaatag |
49879782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University