View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6162_high_5 (Length: 288)
Name: NF6162_high_5
Description: NF6162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6162_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 44515137 - 44515260
Alignment:
| Q |
1 |
agttgtttggaaaatatatttaatttaagattaggtcaattttgaggaaaaaattatttaaggaggg---------gaggatgtaacaccccacattact |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
44515137 |
agttgtttggaaaatatatttaatttaagattaggtcaattttgaggacaaaattatttaagggggggggggacccggggatgtaacaccccacattact |
44515236 |
T |
|
| Q |
92 |
atctctataaataattttgatagg |
115 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44515237 |
atctctataaataattttgatagg |
44515260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 173 - 274
Target Start/End: Original strand, 44515318 - 44515419
Alignment:
| Q |
173 |
ctagacttggtgtttggttgaattaaacctgttctagcttgctattgttgctcatgaccannnnnnnnaacaggggtctgttctatttttggtgttgttt |
272 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44515318 |
ctagacttggtgtttagttgaattaaacctgttctagcttgctattgttgcttatgaccattttttttaacaggggtctgttctatttttggtgttgttt |
44515417 |
T |
|
| Q |
273 |
ct |
274 |
Q |
| |
|
|| |
|
|
| T |
44515418 |
ct |
44515419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 115
Target Start/End: Original strand, 44509645 - 44509679
Alignment:
| Q |
81 |
cccacattactatctctataaataattttgatagg |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44509645 |
cccacattactatctctataaataactttgatagg |
44509679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 71 - 115
Target Start/End: Original strand, 26505297 - 26505341
Alignment:
| Q |
71 |
gatgtaacaccccacattactatctctataaataattttgatagg |
115 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26505297 |
gatgtaacatcccatattactatctctataaataattttgatagg |
26505341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University