View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6162_low_7 (Length: 245)
Name: NF6162_low_7
Description: NF6162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6162_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 51511612 - 51511849
Alignment:
| Q |
1 |
ttcatcttatttctcaaacctcaatattgatcaaaaacttttctgttttgctattaactga-catgaactataacaactgctaaaagaacacgtgattct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51511612 |
ttcatcttatttctcaaacctcaatattgatcaaaaacttttctgttttgctattaactgatcatgaactataacaactgctaaaagaacacgtgattct |
51511711 |
T |
|
| Q |
100 |
tacaaggttgtttgttgtttttgttccaaaaatgaatccttgtgttgtgacttgtgaatatgagaggttccgtgagagttagtcttgttttaatatttga |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51511712 |
tacaaggttgtttgttgtttttgttcctaaaatgaatccttgtgttgtgacttgtgaatatgagaggttccgtgagagttagtcttgttttaatatttga |
51511811 |
T |
|
| Q |
200 |
aaatgtgtgactcactcaatgatcaaaatgatgatgat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51511812 |
aaatgtgtgactcactcaatgatcaaaatgatgatgat |
51511849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University