View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6165_high_7 (Length: 238)
Name: NF6165_high_7
Description: NF6165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6165_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 27442377 - 27442538
Alignment:
| Q |
1 |
ttcaaatgactgtttgatgaaccattcagcaaggttgatgacattgtcttgtcggctatcgtcgagtgctctttttccagttatcatccccattagaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27442377 |
ttcaaatgactgtttgatgaaccattcagcaaggttgatgacattgtcttgttggctgtcgtcgagtgctctttttccagttatcatccccattagaatc |
27442476 |
T |
 |
| Q |
101 |
acaccatagctgtatacgtctacctttgtggtggctcggccggtggctgtgacatatcatac |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27442477 |
acaccatagctgtatacgtctacctttgtggtggctcggccggtggctgtgacatatcatac |
27442538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 159 - 222
Target Start/End: Original strand, 27444191 - 27444254
Alignment:
| Q |
159 |
atacgttgctttcactgaagttgttggtagctcccctcaaaacttgaattgaaacggccatatt |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27444191 |
atacgttgctttcactgaagttgttagtagctcgcctcaaaacttgaattgaaacggccatatt |
27444254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 74 - 161
Target Start/End: Complemental strand, 11837984 - 11837897
Alignment:
| Q |
74 |
tttccagttatcatccccattagaatcacaccatagctgtatacgtctacctttgtggtggctcggccggtggctgtgacatatcata |
161 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
11837984 |
tttccggttatcatctccataagaatcacaccatagctgtatacgtctacctttgtggtgactcggccagtgactgtgacatatcata |
11837897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 75 - 162
Target Start/End: Complemental strand, 11850666 - 11850579
Alignment:
| Q |
75 |
ttccagttatcatccccattagaatcacaccatagctgtatacgtctacctttgtggtggctcggccggtggctgtgacatatcatac |
162 |
Q |
| |
|
|||| ||||||||| |||| |||||||| |||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||| |
|
|
| T |
11850666 |
ttccggttatcatctccataagaatcacgccatagctgtatacgtctacctttgtggtgactcgaccggtgactgtgacatatcatac |
11850579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 69 - 162
Target Start/End: Original strand, 11855850 - 11855943
Alignment:
| Q |
69 |
ctctttttccagttatcatccccattagaatcacaccatagctgtatacgtctacctttgtggtggctcggccggtggctgtgacatatcatac |
162 |
Q |
| |
|
|||| ||||| ||||||||| |||| |||||||| ||||||||||| ||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
11855850 |
ctctctttccggttatcatctccataagaatcacgccatagctgtacacgtctaactttgtggtgactcggccggtgactgtgacatatcatac |
11855943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University