View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6166_high_25 (Length: 231)
Name: NF6166_high_25
Description: NF6166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6166_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 212
Target Start/End: Original strand, 30942946 - 30943151
Alignment:
| Q |
10 |
aggagcagagaccatcaaacatgttttctaaatagatgcatggacnnnnnnnngaaaata----gatagacaaattacactagagaaacatgcacatcat |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30942946 |
aggatcagagaccatcaaacatgttttctaaatagatgcatggacaaaaaaaaaaaaaaaaattgatagacaaattacactagagaaacatacacatcat |
30943045 |
T |
 |
| Q |
106 |
tttggtgtgtgcttttcaaaaaggaaattccaaaattgtctatgagaaatatttagtcagacctcgccgaacacctttagcaggatctctcctctcaacc |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
30943046 |
tttggtgtgtgcttttcaaaaagggaattccaaaattgtctatgagaaatatttggtcagaccttgccgaacacctttagcaggatctctcctct-aacc |
30943144 |
T |
 |
| Q |
206 |
acttttt |
212 |
Q |
| |
|
||||||| |
|
|
| T |
30943145 |
acttttt |
30943151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University