View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6166_low_8 (Length: 447)
Name: NF6166_low_8
Description: NF6166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6166_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 17 - 283
Target Start/End: Original strand, 40439469 - 40439735
Alignment:
| Q |
17 |
cctaacagcagcagcatcaccgcgttgcgcggcaagatgaagctcggtgtcattatgacgaccggtgacctgtttaacatattttttcttgctgggtgtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40439469 |
cctaacagcagcagcatcaccgcgttgcgcggcaagatgaagctcggtgtcattatgacgaccggtgacctgtttaacatattttttcttgcagggtgtc |
40439568 |
T |
 |
| Q |
117 |
tcgacgaggcgtttgccggaattggaaatgacgagggatttgttggagtttgagacaagaagggctttgccggaagtggagaggaatagggtgggtcttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40439569 |
tcgacgaggcgtttgccggaattggaaatgacgagggatttgttggagtttgagacaagaagggctttgcccgaagtggagaggaatagggtgggtcttg |
40439668 |
T |
 |
| Q |
217 |
gggtggttggagtgttgggttcagaaagaggagcgtggccgccggggtgatccatgaatggccgtcg |
283 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439669 |
gggtggttggggtgttgggttcagaaagaggagcgtggccgccggggtgatccatgaatggccgtcg |
40439735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 342 - 441
Target Start/End: Original strand, 40439794 - 40439893
Alignment:
| Q |
342 |
tgccccattcctcaacccttcaatccctcctctgtttttgttgatctgcaccattggcggaaaaactccaaacaaatatcgttgctttctctgctcctcc |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||| |
|
|
| T |
40439794 |
tgccccattcctcaacccttcaatccctcctctgtttttgttgatctgcaccattggcggaataactccaaacaaatatcgttgctttctttggtcctcc |
40439893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University