View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6168_low_6 (Length: 213)
Name: NF6168_low_6
Description: NF6168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6168_low_6 |
 | |
|
| [»] scaffold0259 (1 HSPs) |
| | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0259 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 33 - 194
Target Start/End: Original strand, 19778 - 19939
Alignment:
| Q |
33 |
cacattatttttaccttcattaaaacgaacattagaactgttcatctttctttgttgatgttctcatatttgattaaagaaatcgcagtcgtcagagaaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19778 |
cacattatttttaccttcattaaaacgaacattagaacagttcatctttctttcttgatgttctcatatttgattaaagaaatcgcagtcgtcagagaaa |
19877 |
T |
|
| Q |
133 |
atacttgatatcctttgaatcgatttatgttgcatagcttgttgatctaatagagagaaaac |
194 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19878 |
atacttgatatcctttgtatcgatttatgttgcatagcttgttgatctaatagagagaaaac |
19939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 33 - 187
Target Start/End: Original strand, 14829754 - 14829908
Alignment:
| Q |
33 |
cacattatttttaccttcattaaaacgaacattagaactgttcatctttctttgttgatgttctcatatttgattaaagaaatcgcagtcgtcagagaaa |
132 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||||||| ||||||||||||||||||||||||| ||||| ||||||||||| ||||||| | |||||| |
|
|
| T |
14829754 |
cacattatttttacctttattaaaaagatcattagaacaattcatctttctttgttgatgttctcgtatttaattaaagaaattgcagtcgccggagaaa |
14829853 |
T |
|
| Q |
133 |
atacttgatatcctttgaatcgatttatgttgcatagcttgttgatctaatagag |
187 |
Q |
| |
|
|||| ||||| |||||||||||| |||| ||||| ||||||| |||||||||||| |
|
|
| T |
14829854 |
atacatgatagcctttgaatcgagttatattgcacagcttgtagatctaatagag |
14829908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 88 - 187
Target Start/End: Original strand, 117269 - 117368
Alignment:
| Q |
88 |
tgatgttctcatatttgattaaagaaatcgcagtcgtcagagaaaatacttgatatcctttgaatcgatttatgttgcatagcttgttgatctaatagag |
187 |
Q |
| |
|
|||||||||||||| | ||| |||||||| || | ||||||||||| || ||| |||||||||||| || ||||||||||||||| |||||| ||||| |
|
|
| T |
117269 |
tgatgttctcatatataattgaagaaatcacaactgccagagaaaatatttaatagcctttgaatcgagttttgttgcatagcttgtagatctagtagag |
117368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University