View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6170_high_12 (Length: 306)
Name: NF6170_high_12
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6170_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 138 - 288
Target Start/End: Complemental strand, 42394449 - 42394299
Alignment:
| Q |
138 |
atagtagatcaaaaatagatatatttaccacaatacgaagtcgagatctttgtgtatccggcatatgtggaagtaactctacactatcaggtacacaatg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42394449 |
atagtagatcaaaaatagatatatttaccacaatacgaagtcgagatctttgtgtatccggcatacgtggaagtaactctacactatcaggtacacaatg |
42394350 |
T |
|
| Q |
238 |
gacgccctcaattgttgttccctcacttatggctgttaagtgcctcttatg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394349 |
gacgccctcaattgttgttccctcacttatggctgttaagtgcctcttatg |
42394299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 42394694 - 42394557
Alignment:
| Q |
1 |
ttcaatgcagagatatctaggtatgtgtggcagcatctactagaattgatccaaagtagtgtcacatgaaacatagtcaataacttcatacttacggtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394694 |
ttcaatgcagagatatctaggtatgtgtggcagcatctactagaattgatccaaagtagtgtcacatgaaacatagtcaataacttcatacttacggtat |
42394595 |
T |
|
| Q |
101 |
accatattcctaaaacactaagtatggattaaaagaca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394594 |
accatattcctaaaacactaagtatggattaaaagaca |
42394557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University