View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6170_high_19 (Length: 251)
Name: NF6170_high_19
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6170_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 19231814 - 19232034
Alignment:
| Q |
13 |
attctcacgcaaaccacacgcgcttcgcgtgtggttactgaacacgcttacgaccctcgctctcatgcatggcttcagattaagcaccaaccgttgatca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19231814 |
attctcacgcaaaccacacgcgcttcgcgagtggttaccgaacacgcttacgaccctcgctctcatgcatggcttcagattaagcaccaaccgttgatca |
19231913 |
T |
|
| Q |
113 |
ccaaagctagtgaattccctaccgttagatcatctcattcgactcttctctacacgttgaccccatcggagtttactttttccattgatgcacttcatct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19231914 |
ccaaagctagtgaattccctaccgttagatcatctcattcgactcttctctacacgttgaccccatcggagttcactttttccattgatgcacttcatct |
19232013 |
T |
|
| Q |
213 |
taaatggcaccatgcaccttc |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19232014 |
taaatggcaccatgcaccttc |
19232034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 58 - 194
Target Start/End: Complemental strand, 14630143 - 14630004
Alignment:
| Q |
58 |
gcttacgaccctcgctctcatgcatggcttcagat---taagcaccaaccgttgatcaccaaagctagtgaattccctaccgttagatcatctcattcga |
154 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||| ||| |||||||||||||||| |||| || ||| | || || |||||||||||||||| | |
|
|
| T |
14630143 |
gcttatgatcctcgctctcatgcgtggcttcagataactaaacaccaaccgttgatcaacaaaactcaggaaattccagccattagatcatctcattcaa |
14630044 |
T |
|
| Q |
155 |
ctcttctctacacgttgaccccatcggagtttactttttc |
194 |
Q |
| |
|
|||| || ||||| || |||||||||||||||| ||||| |
|
|
| T |
14630043 |
ctctgctttacaccttatccccatcggagtttacgttttc |
14630004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University