View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6170_high_21 (Length: 236)
Name: NF6170_high_21
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6170_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 218
Target Start/End: Complemental strand, 54804225 - 54804021
Alignment:
| Q |
14 |
attattcttcatttgtgaaccagagttgagtgaacgattattaatgggaatagataggtctgataagaaataaagcatatatgattttattccttacgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
54804225 |
attattcttcatttgtgaaccagagttgagtgaacgattattaatgggaatagataggtctgataagaaataaagcttatatgattttattccttactaa |
54804126 |
T |
|
| Q |
114 |
agattaaaattgctgataaaataacaagtgagtaagctcaaatggttaatgagttttagctaaagataaataaataaggagaacttgtgtttgaatctcg |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54804125 |
agattaaaattgctgataaaataataagtgagtaagctcaaatggttaatgagttttagttaaagataaataaataaggagaacttgtgtttgaatctcg |
54804026 |
T |
|
| Q |
214 |
gttca |
218 |
Q |
| |
|
||||| |
|
|
| T |
54804025 |
gttca |
54804021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University