View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6170_high_7 (Length: 419)
Name: NF6170_high_7
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6170_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 15 - 403
Target Start/End: Original strand, 5713369 - 5713759
Alignment:
| Q |
15 |
caaaggggatgcctaggaaaaggagaaacattactatgggcatggaagagatacaaagaagttgatcagtcaatgatagagatacatgcaaaaagtgtca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713369 |
caaaggggatgcctaggaaaaggagaaacattaatatgggcatggaagagatacaaagaagttgatcagtcaatgatagagatacatgcaaaaagtgtca |
5713468 |
T |
 |
| Q |
115 |
ctaatggtctcatcattatgctagggaaagtagagatgtgtcgttttctgcggtgtaatggaagcattgttaggcactacacaagcggtatcatcaatgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713469 |
ctaatggtctcatcattatgctagggaaagtagagatgtgtcgttttctgcggtgtaatggaagcattgttaggcactacacaagcggtatcatcaatgt |
5713568 |
T |
 |
| Q |
215 |
cgaagagccagtaaaaagcttgaaaaggtgggtctcatgcaggctggacgaggacgacccatcaccacccaaaaatctgccgaatttgactgc--ttgtg |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
5713569 |
cgaagagccagtgaaaagcttgaaaaggtgggtctcatgcaggctggacgaggacgacccatcaccactcaaaaatctgtcgaatttgactgcttttgtg |
5713668 |
T |
 |
| Q |
313 |
gttgggaacagatcatagacattgacagagctcttgttcatccacagccagaattgctagatgcagttcgcggtgcaaggaccgaagaaac |
403 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713669 |
gttgggaacagatcatagacattgacatagctcttgttcatccacagccagaattgctagatgcagttcgcggtgcaaggaccgaagaaac |
5713759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University