View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6170_low_16 (Length: 264)
Name: NF6170_low_16
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6170_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 3616369 - 3616520
Alignment:
| Q |
19 |
ggatgaatttatgatggtggtgtgtgatgaatttgggagaagaagatatgaagattcctggagttgaaggaattgttggtgatgaaggaattctggaa-n |
117 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3616369 |
ggatgaatttatgatggcggtgtctgatgaatttgggagaagaagatatgaagattcctggagatgaaggaattgttggtgatgaaggaattctggaatt |
3616468 |
T |
 |
| Q |
118 |
nnnnnnnnggaacgctgatatagatatgaggaagaagataagagataaacca |
169 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3616469 |
tttattttggaacgctgatatagatctgaggaagaagataagagataaacca |
3616520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 17 - 112
Target Start/End: Original strand, 52077639 - 52077734
Alignment:
| Q |
17 |
agggatgaatttatgatggtggtgtgtgatgaatttgggagaagaagatatgaagattcctggagttgaaggaattgttggtgatgaaggaattct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
52077639 |
agggatgaatttatgatggtggtgtgtgatgaatttgggagaagaagatatgaagattcctggagacgaaggcattgttggtgatgaaggaattct |
52077734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 255
Target Start/End: Original strand, 3616566 - 3616609
Alignment:
| Q |
212 |
ctgggtttattattaatagaaatcaatggtgatcatgatgatgt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3616566 |
ctgggtttattattaatagaaatcaatggtgatcatgatgatgt |
3616609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 212 - 251
Target Start/End: Original strand, 52077842 - 52077881
Alignment:
| Q |
212 |
ctgggtttattattaatagaaatcaatggtgatcatgatg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52077842 |
ctgggtttattattaatagaaatcaatggtgatgatgatg |
52077881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 48
Target Start/End: Original strand, 12666957 - 12666985
Alignment:
| Q |
20 |
gatgaatttatgatggtggtgtgtgatga |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12666957 |
gatgaatttatgatggtggtgtgtgatga |
12666985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 21 - 169
Target Start/End: Complemental strand, 16756516 - 16756359
Alignment:
| Q |
21 |
atgaatttatgatggtggtgtgtgatgaattt--------gggagaagaagatatgaagattcctggagttgaaggaattgttggtgatgaaggaattct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16756516 |
atgaatttatgatggtggtgtgtgatgaatttatgaatttgggagaagaagatatgaagattcatggagatgaaggaattgttggtgatgaaggaattct |
16756417 |
T |
 |
| Q |
113 |
ggaannnnnnnnngg-aacgctgatatagatatgaggaagaagataagagataaacca |
169 |
Q |
| |
|
| | || ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16756416 |
gaattttttttttggcaacgctgatatagatatgaggaagaagatgagagataaacca |
16756359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 213 - 255
Target Start/End: Complemental strand, 16756312 - 16756270
Alignment:
| Q |
213 |
tgggtttattattaatagaaatcaatggtgatcatgatgatgt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16756312 |
tgggtttattattaatagaaatcaatggtgatgatgatgatgt |
16756270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University