View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6170_low_20 (Length: 251)
Name: NF6170_low_20
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6170_low_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 44150414 - 44150656
Alignment:
| Q |
9 |
gagatgaatgaagttttattttactaaggagaatgagaaaatatagatcgacctttcacatgcattgacaaaacaatttagttaatgatattctattatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44150414 |
gagatgaatgaagttttattttactaaggagaaagagaaaatatagatcgacctttcacatgcattgacaaaacaatttagttaatgatattctattatt |
44150513 |
T |
 |
| Q |
109 |
attctatatatgaatacaaaataaattttgaaacgtgtgtggaaaacaagttgtgccctttcacaacaagaattaatgaagagtttttctttcacaacac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44150514 |
attctatatatgaatacaaaataaattttgaaacgtgtgtggaaaacaagttgtgccctttaacaacaagaattaatgaagagtttttctttcacaacac |
44150613 |
T |
 |
| Q |
209 |
ggggccagagctagctagctagacttttaacaaaggaagtaac |
251 |
Q |
| |
|
||||||| ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
44150614 |
ggggccatagctagctagctagacttttaacgatggaagtaac |
44150656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University