View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6170_low_25 (Length: 216)
Name: NF6170_low_25
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6170_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 196
Target Start/End: Original strand, 10613094 - 10613275
Alignment:
| Q |
15 |
cagagaggctgaaggttttgtgacgttcaagatcagtacacagtggttcgaatggtggaggtttttctggaaagtgttctagcacaatggctaactgtgg |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10613094 |
cagaaaggctgaaggttttgtgacgttcaagatcagtacacagtggttcgaatggtggaggtttttctggaaagtgttctagcacaatggctaactgtgg |
10613193 |
T |
|
| Q |
115 |
ttgatggcggccatggtcgttgtaagtggacgcagctaggaaagtcgggtgagggcagtgaacacaacatagaacagaatgc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10613194 |
ttgatggcggccatggtcgttgtaagtggaagcagctaggaaagttgggtgagggcagtgaacacaacatagaacagaatgc |
10613275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University