View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6170_low_26 (Length: 214)

Name: NF6170_low_26
Description: NF6170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6170_low_26
NF6170_low_26
[»] chr4 (1 HSPs)
chr4 (1-199)||(52551973-52552171)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 52551973 - 52552171
Alignment:
1 aaatgtcagggctttggaaaatatagtttaagccattacttttgaatttgaattaacttgtaaaacaagttctttcctaaaaaagaaatggattagtcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52551973 aaatgtcagggctttggaaaatatagtttaagccattacttttgaatttgaattaacttgtaaaacaagttctttcctaaaaaagaaatggattagtcct 52552072  T
101 tcgtgaccaaatgttgccgcatgtcgcactggtaccgatgaggcaaattctttggttaagttgaatttggatcttttatccttacaaggcacttataac 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52552073 tcgtgaccaaatgttgccgcatgtcgcactggtaccgatgaggcaaattctttggttaagttgaatttggatcttttatccttacaaggcacttataac 52552171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University