View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6172_low_4 (Length: 270)
Name: NF6172_low_4
Description: NF6172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6172_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 261
Target Start/End: Original strand, 21225468 - 21225719
Alignment:
| Q |
10 |
catcatcatcatatgagtggtcagaaccttgctcatcaatgctgattaagttttttgatgcagaagtataaccgttggaagactcgacccagctacttgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21225468 |
catcatcatcatatgagtggtcagaaccttgctcatcaatgctgattaagttttttgatgcagaagcataaccgttggaagactcgacccagctacttgg |
21225567 |
T |
 |
| Q |
110 |
tccagatttgtcaatcacaggcggataatatatattatcaaagtcttcctgaaaatggtttcaagcaaaatttagtcattgttaatattgaagatgatga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21225568 |
tccagatttgtcaatcacaggcggataatatatattatcaaagtcttcctgaaaatggtttcaagcaaaatttagtcattgttaatattgaagaggatga |
21225667 |
T |
 |
| Q |
210 |
catcaatcaggtgcaagaaaaaagtcttattcacaaaccatagtttgatgat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21225668 |
catcaatcaggtgcaagaaaaaagtcttattcacaaaccatagtttgatgat |
21225719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University