View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6173_high_6 (Length: 264)
Name: NF6173_high_6
Description: NF6173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6173_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 9 - 256
Target Start/End: Complemental strand, 32505028 - 32504781
Alignment:
| Q |
9 |
acatcatcaaactgtagtaagttagtttaacaatgttggggaatgtaaatttaaggtatgattttgaaattttctataattgactcacaataggtcttac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
32505028 |
acatcatcaaactgtagtaagttagtttaacaatgttggggaatgtaaatttaaggtatgattttgaaatttactgtaattgactcacaataggtcttac |
32504929 |
T |
 |
| Q |
109 |
tatttttagaccctgttatgatgatagttttttatgagatagttactgctgatttgtatgcatgcaatttgtttaagcatgcaccatcgaccaacaattg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32504928 |
tatttttagaccctgttatgatgatagttttttatgagatagttactgctgatttgtatgcatgcaatttgtttaagcatgcaccattgaccaacaattg |
32504829 |
T |
 |
| Q |
209 |
aaagtatagcataggctttgtttataatttgtaacaatatatgatgat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504828 |
aaagtatagcataggctttgtttataatttgtaacaatatatgatgat |
32504781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University