View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6173_low_4 (Length: 288)

Name: NF6173_low_4
Description: NF6173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6173_low_4
NF6173_low_4
[»] chr1 (1 HSPs)
chr1 (89-272)||(35916366-35916549)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 89 - 272
Target Start/End: Complemental strand, 35916549 - 35916366
Alignment:
89 gaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaacagcttgagcccaatgtcttaacttgg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
35916549 gaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaacagcttgagcccaatgtcttaatttgg 35916450  T
189 tcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaat 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35916449 tcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaat 35916366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University