View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6173_low_4 (Length: 288)
Name: NF6173_low_4
Description: NF6173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6173_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 89 - 272
Target Start/End: Complemental strand, 35916549 - 35916366
Alignment:
| Q |
89 |
gaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaacagcttgagcccaatgtcttaacttgg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35916549 |
gaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaacagcttgagcccaatgtcttaatttgg |
35916450 |
T |
|
| Q |
189 |
tcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916449 |
tcttcaccaattcaggatcatcccctacattgcacaaagatgcaaacccgcaacctcgtcagcaaaactatacatgcatttaat |
35916366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University