View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6173_low_9 (Length: 247)
Name: NF6173_low_9
Description: NF6173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6173_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 10079074 - 10078839
Alignment:
| Q |
8 |
ggacatcatcatgtcgtgaattattttctggaccgagttctgagcatcattactagggtcggcttcaccagaaacagatgcctgctgttgttgcatggaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10079074 |
ggacatcatcatgtcgtgaattattttctggaccgagttctgagcatcattactagggtcagcttcaccagaaacagatgcctgctgttgttgcatggaa |
10078975 |
T |
|
| Q |
108 |
atattagctggtgagtttactgtacccatgtgatttgcagatgttaagccagggtgagaagtttgtgggttgttgttagatgaggacggtgttggtgaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10078974 |
atattagctggtgagtttactgtacccatgtgatttgcagatgttaagccagggtgagaagtttgcgggttgttgttagatgaggacggtgttggtgaat |
10078875 |
T |
|
| Q |
208 |
gaaaaggggacgagtttggttgtgcctgtggcactg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10078874 |
gaaaaggggacgagtttggttgtgcctgtggcactg |
10078839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 241
Target Start/End: Original strand, 40776005 - 40776081
Alignment:
| Q |
168 |
gtttgtgggttgttgttagatgaggacggtgt---tggtgaatgaaaaggggacgagtttggttgtgcctgtggcac |
241 |
Q |
| |
|
||||||||| ||| ||||||||||| ||||| |||||| ||||||||||| |||||||| || ||||||||||| |
|
|
| T |
40776005 |
gtttgtggggggttattagatgaggatggtgtaggtggtgactgaaaaggggatgagtttggctgggcctgtggcac |
40776081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University