View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6176_high_28 (Length: 247)
Name: NF6176_high_28
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6176_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 115 - 231
Target Start/End: Complemental strand, 7897129 - 7897013
Alignment:
| Q |
115 |
gtctaacttttcttaatgttttatattgcagggtgattatgagtgctttggatcgttgttgagagagagaggaagtaagatgttttgcattgaacatcat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897129 |
gtctaacttttcttaatgttttatattgcagggtgattatgagtgctttggatcgttgttgagagagagaggaagtaagatgttttgcattgaacatcat |
7897030 |
T |
 |
| Q |
215 |
cattcggcatctaactg |
231 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
7897029 |
cgttcggcatctaactg |
7897013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7897244 - 7897196
Alignment:
| Q |
1 |
atcggagagctccgattatcgaagtccgactatttccgattggttatct |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897244 |
atcggagagctccgattatcgaagtccgactatttccgattggttatct |
7897196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University