View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6176_low_19 (Length: 312)
Name: NF6176_low_19
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6176_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 300
Target Start/End: Complemental strand, 12683185 - 12682904
Alignment:
| Q |
19 |
atgcctcaacctcagtttttggccacctagaagaacttgcatgcatcatactctcaccattgttatcacttttcgcaacttccatattcgtcacttgctg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12683185 |
atgcctcaacctcagtttttggccacctagaagaacttgcatgcatcatactctcaccattgttatcacttttcgcaacttccatattcatcacttgctg |
12683086 |
T |
 |
| Q |
119 |
ctgttgtacctgaacctgctgttgctgctgctgatgttgtggcaatggtgaagcctgaggaatgactgatgtttgttgttgcactgttacagttggattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683085 |
ctgttgtacctgaacctgctgttgctgctgctgatgttgtggcaacggtgaagcctgaggaatgactgatgtttgttgttgcactgttacagttggattt |
12682986 |
T |
 |
| Q |
219 |
tgaacttgctgcggtgtaggtattgctggtatcggtatcggcaatggtgctgctgctgctggcaacggtactggtgttggtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12682985 |
tgaacttgctgcggtgtaggtattgctggtatcggtattggcaatggtgctgctgctgctggcaacggtactggtgttggtg |
12682904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University