View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6176_low_21 (Length: 304)
Name: NF6176_low_21
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6176_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 2 - 281
Target Start/End: Original strand, 35272708 - 35272987
Alignment:
| Q |
2 |
tcgagagagaagaattgacttcgttctagagaaaaacataaatgacttcttttatgttgactagtaactaactgatccgattttggtaatgtaagcaaat |
101 |
Q |
| |
|
|||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35272708 |
tcgagaaaaaagatttgacttcgttctagagaaaaacataaatgacttcttttatgttgactagtaactaactgatcagattttggtaatgtaagcaaat |
35272807 |
T |
|
| Q |
102 |
attgagtccgnnnnnnntaaagataataacaaattttgcaccgatctttctttcaaaaaacaaacttttcaccgatattaaatcgcttatttatacttgt |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35272808 |
attgagtccgaaaaaaataaagataataacaaattttgcaccgatctttctttcaaaaaacaaacttttcaccgatattaaatcgcttatttatacttgt |
35272907 |
T |
|
| Q |
202 |
tttaaaaaccctaatcatattttctggcgctctcttcataacaaatcttttcttctcttccaatagctttatcgcttccc |
281 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35272908 |
ttgaaaaaccctaatcatattttctggcgctctcttcataacaaatcttttcttctcttccaatagctttatcgcttccc |
35272987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University