View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6176_low_24 (Length: 264)
Name: NF6176_low_24
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6176_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 29 - 257
Target Start/End: Complemental strand, 53601927 - 53601699
Alignment:
| Q |
29 |
tgtcaatgtcgtgttttataggttatgattatgagtaaaggtgaagattacctgccaacgatgccattaaccatgatgacaaggtgaggaggaatggggt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53601927 |
tgtcaatgtcgtgttttataggttatgattatgagtaaaggtgaagattacctgccaacgatgccattaaccatgatgacaaggtgaggaggaatagggt |
53601828 |
T |
|
| Q |
129 |
tgttagcatcactattatcttctactttggggttgttcaaacaacttcctccaaatcgccgatgatgaaatttcattttgataatccaaaaagcgatgag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53601827 |
tgttagcatcactattatcttctactttggggttgttcaaacaacttcctccaaatcgccgatgatgaaatttcattttgataatccaaaaagcgatgag |
53601728 |
T |
|
| Q |
229 |
aagagatccaaataataataatgatgatg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53601727 |
aagagatccaaataataataatgatgatg |
53601699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University