View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6176_low_26 (Length: 254)
Name: NF6176_low_26
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6176_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 27989757 - 27989528
Alignment:
| Q |
12 |
atgaaagatatattatatataaataagccggtctaacgggataataggcttttttgtaagcctcaacctaaactacttcactaaataggcttcataagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27989757 |
atgaaagatatattatatataaataagccgatctaacggaataacaggcttttttgtaagcctcaacctaaactacttcactaaataggcttcataagaa |
27989658 |
T |
 |
| Q |
112 |
gtttgagactaacattgggttgtgtcgggctaggctttaaataggttaggtcgtaggcctctgtcaggtagtctggcctgttcccatccctatttgcaaa |
211 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
27989657 |
gtttgagactaatattgggttgtgtcaggctaggctttaaataggttaggtcgtaagcctctgtcagatagtctggcctgttcccacccctatttgcaaa |
27989558 |
T |
 |
| Q |
212 |
ggagatagtggaattttagatgcaatttgt |
241 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
27989557 |
ggagatagtggaattttaggtgcaatttgt |
27989528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 28000214 - 27999986
Alignment:
| Q |
12 |
atgaaagatatattatatataaataagccggtctaacgggataataggcttttttgtaagcctcaacctaaactacttcactaaataggcttcataagaa |
111 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
28000214 |
atgaaagatatattatatacaaataggccggtctaacgggctaatagacttttttgtaagcctcaacctagactacttcactaattaggcttcacaagaa |
28000115 |
T |
 |
| Q |
112 |
gtttgagactaacattgggttgtgtcgggctaggctttaaataggttaggtcgtaggcctctgtcaggtagtctggcctgttcccatccctatttgcaaa |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| | ||| |||||||||||| |||| ||| |||||||||| ||||| || |||| |
|
|
| T |
28000114 |
gtttgagactaacattgagttgtgtcgggctacgctttaaataggtcaaatcgcaggcctctgtcaagtagcctgacctgttccca-ccctaatttcaaa |
28000016 |
T |
 |
| Q |
212 |
ggagatagtggaattttagatgcaatttgt |
241 |
Q |
| |
|
|||||||||| || ||||| |||||||||| |
|
|
| T |
28000015 |
ggagatagtgaaactttaggtgcaatttgt |
27999986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 203
Target Start/End: Complemental strand, 55463170 - 55463107
Alignment:
| Q |
140 |
gctaggctttaaataggttaggtcgtaggcctctgtcaggtagtctggcctgttcccatcccta |
203 |
Q |
| |
|
|||| |||||||||||| |||||| ||||||| |||| || |||||||| |||||||| ||||| |
|
|
| T |
55463170 |
gctatgctttaaataggctaggtcctaggcctatgtcgggcagtctggcatgttcccaccccta |
55463107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 5628886 - 5628850
Alignment:
| Q |
140 |
gctaggctttaaataggttaggtcgtaggcctctgtc |
176 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
5628886 |
gctaagctttaaataggttaggttgtaggcctctgtc |
5628850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 108
Target Start/End: Complemental strand, 32878943 - 32878888
Alignment:
| Q |
53 |
taataggcttttttgtaagcctcaacctaaactacttcactaaataggcttcataa |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||| || ||||||||||||| |||| |
|
|
| T |
32878943 |
taataggcttttttgtaagccttaaccttacctatttaactaaataggctttataa |
32878888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University