View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6176_low_32 (Length: 242)
Name: NF6176_low_32
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6176_low_32 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 41189302 - 41189525
Alignment:
| Q |
19 |
tgaattgtgcatccaattagaaatataattattttcttgtttattcctccactgagattctgaatgcgacctattttgggtcacaaaaaccttgcctaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41189302 |
tgaattgtgcatccaattagaaatataattattttcttgtttattcctccactgagattctgaatgcgacctattttgggtcacaaaaaccttgcctaga |
41189401 |
T |
 |
| Q |
119 |
ctaataatcacaccaaagtcaaaaatcatattcagatatctaaataaacatttatcagtatggataatatgatatctctatctgtctcattgaatacaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41189402 |
ctaataatcacaccaaagtcaaaaatcatattcagatatctaaataaacatttatcggtatggataatatgatatctctatccatctcattgaatacaat |
41189501 |
T |
 |
| Q |
219 |
acatataatatttgtgtccacttc |
242 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
41189502 |
atatataatatttgtgtccacttc |
41189525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University