View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6176_low_36 (Length: 222)
Name: NF6176_low_36
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6176_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 44 - 204
Target Start/End: Complemental strand, 8232086 - 8231927
Alignment:
| Q |
44 |
ataaaagaaaaatctagattgagtggatgataccctaattcaagacaaataatacttacgagctcatatacgtataaatgaagaatttacagtaacatct |
143 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
8232086 |
ataaaagaaaaatctagattgaatggatgataccctaattcaagacaaataatacttacgagctcaaatatgtataaatgaagaatttacagttacatct |
8231987 |
T |
 |
| Q |
144 |
tatggtaatattaacatatactttagtcatatctcaattgtagataaacttaagggttaac |
204 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
8231986 |
tatggtaata-taacatatactttagtcatatctcaattgtaaataaacttaaggattaac |
8231927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University