View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6176_low_36 (Length: 222)

Name: NF6176_low_36
Description: NF6176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6176_low_36
NF6176_low_36
[»] chr8 (1 HSPs)
chr8 (44-204)||(8231927-8232086)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 44 - 204
Target Start/End: Complemental strand, 8232086 - 8231927
Alignment:
44 ataaaagaaaaatctagattgagtggatgataccctaattcaagacaaataatacttacgagctcatatacgtataaatgaagaatttacagtaacatct 143  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||    
8232086 ataaaagaaaaatctagattgaatggatgataccctaattcaagacaaataatacttacgagctcaaatatgtataaatgaagaatttacagttacatct 8231987  T
144 tatggtaatattaacatatactttagtcatatctcaattgtagataaacttaagggttaac 204  Q
    |||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||    
8231986 tatggtaata-taacatatactttagtcatatctcaattgtaaataaacttaaggattaac 8231927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University