View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6177_high_8 (Length: 256)
Name: NF6177_high_8
Description: NF6177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6177_high_8 |
 |  |
|
| [»] scaffold0227 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0227 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 121
Target Start/End: Complemental strand, 9720 - 9611
Alignment:
| Q |
14 |
gaagaatatcatttttaacagaagagagggaaaaacatagttagggg--tgtctatgcttttttaacatattagtgaaatactatatgcatagctttcaa |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9720 |
gaagaaaatcatttttaacagaagagagggaaaaacatagttaggggggtgtctatgcttttttaacatattagtgaaatactatatgcatagttttcaa |
9621 |
T |
 |
| Q |
112 |
acttgaatgc |
121 |
Q |
| |
|
|||||||||| |
|
|
| T |
9620 |
acttgaatgc |
9611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 193 - 240
Target Start/End: Complemental strand, 9539 - 9492
Alignment:
| Q |
193 |
agcaaacaggtccatggtatgatttactccttccatggtagtgcaagc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9539 |
agcaaacaggtccatggtatgatttactccttccatggtagtgcaagc |
9492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 14 - 121
Target Start/End: Complemental strand, 35386135 - 35386022
Alignment:
| Q |
14 |
gaagaatatcatttttaacagaagagagggaaaaacatagttaggggtgtctatgcttttttaacatattagtgaaatactat------atgcatagctt |
107 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||| ||||||| |||||||||||||||| ||| ||||||||||||||||| |||||||| || |
|
|
| T |
35386135 |
gaagaaaatcatttttaatagaagagagggaaaagcatagttcatggtgtctatgctttttcaacgtattagtgaaatactattttgacatgcatagttt |
35386036 |
T |
 |
| Q |
108 |
tcaaacttgaatgc |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35386035 |
tcaaacttgaatgc |
35386022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 14 - 96
Target Start/End: Original strand, 28090224 - 28090306
Alignment:
| Q |
14 |
gaagaatatcatttttaacagaagagagggaaaaacatagttaggggtgtctatgcttttttaacatattagtgaaatactat |
96 |
Q |
| |
|
|||||| || |||||||| ||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28090224 |
gaagaaaatgatttttaatagaagagagtgaaaaacatagttcatggtgtctatgcttttttataatattagtgaaatactat |
28090306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 193 - 240
Target Start/End: Complemental strand, 35385929 - 35385882
Alignment:
| Q |
193 |
agcaaacaggtccatggtatgatttactccttccatggtagtgcaagc |
240 |
Q |
| |
|
||||||| || |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
35385929 |
agcaaacgggcccatagtatgatttactccttccatggtagtgtaagc |
35385882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University