View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6177_low_15 (Length: 238)
Name: NF6177_low_15
Description: NF6177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6177_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 32881998 - 32881790
Alignment:
| Q |
17 |
agtgttgggagagaaaagaaaaggtaacggaagtagttagttattgtggtgagacgaactcgaaggaagaaggttcaatgaaatgagatgcgattttaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32881998 |
agtgttgggagagaaaagaaaaggtaacggaagtagtcagttattgtggtgagacgaactcgaaggaagaaggttcaatgaaatgagatgcgattttaaa |
32881899 |
T |
|
| Q |
117 |
taagatgaagttggttgagagaatataataactattatgattatgatgattgattgactggtcttac---ttttttggattgagggggatatggggttat |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32881898 |
taagatgaagttggttgagaga--ataataactattatgattatgatgattgattgactggtcttactttttttttggattgagggggatatggggttat |
32881801 |
T |
|
| Q |
214 |
gattgtctgtg |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
32881800 |
gattgtctgtg |
32881790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University