View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_high_27 (Length: 410)
Name: NF6178_high_27
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 18 - 340
Target Start/End: Complemental strand, 25932830 - 25932522
Alignment:
| Q |
18 |
acaagtggcacaatttggtgcattcaagccatcattgtacggcccagatttgttcaatgagttttattaagtac---tagtactnnnnnnntctcatatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
25932830 |
acaagtggcacaatttggtgcattcaagccatcattgtacggcccagatttgttcaatgagttttattaagtacaactagtactaaaaaattctcatatt |
25932731 |
T |
 |
| Q |
115 |
tgataacattttaagcagtttcattataggctccaattttattttattttggcaaaggattacagacaccaaatttaactaaaactgattagtcatggaa |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25932730 |
tgatatcattttaagcagtttcattataggctccaattttattttattttggcaaa-----------------tttaactaaaactgattagtcatggaa |
25932648 |
T |
 |
| Q |
215 |
tttacattttcaagtttgnnnnnnngatggtgtgtggtaggtttttctcaatccatttatgtttctttttgggcaagtttaaatcttacccattctcaag |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25932647 |
tttacattttcaagtttgaaaaaaagatggtgtgtggtaggtttttctcaatccatttaagtttctttttgggcaagtttaaatcttacccattctcaag |
25932548 |
T |
 |
| Q |
315 |
tctttagaaaccatttattgaatcat |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25932547 |
tctttagaaaccatttattgaatcat |
25932522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University