View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_high_56 (Length: 300)
Name: NF6178_high_56
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 137 - 281
Target Start/End: Original strand, 41997574 - 41997716
Alignment:
| Q |
137 |
catatcaatagattgaacatttgtatttatatgttagaccaaatgtttaaaacaagaacttgccgagaatcccgcagcattgtttgacaaccaaaaatcc |
236 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41997574 |
catatcactagattgaacatttgtatttatatgtgagaccaaatgtttaaaacaagaacttgccgagaatcccgcagcattgtttgacaaccaaaaatcc |
41997673 |
T |
|
| Q |
237 |
acactaaattcagtatcttaattattgtaacatatgtaagatatc |
281 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41997674 |
acac--aattcagtatcttaattattgtaacatatgtaagatatc |
41997716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 10 - 105
Target Start/End: Original strand, 41997479 - 41997574
Alignment:
| Q |
10 |
ggacattacccctcttttgagcaaatgtctctagttgctattcttcctttaagtaatacccaaactataaccttagctttagatgaaacgtaaatc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41997479 |
ggacattacccctcttttgagcaaatgtctctagttgctattcttcctttaagtaatcctcaaactataaccttagctttagatgaaacataaatc |
41997574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University