View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6178_high_59 (Length: 292)
Name: NF6178_high_59
Description: NF6178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6178_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 139 - 286
Target Start/End: Complemental strand, 34370751 - 34370607
Alignment:
| Q |
139 |
ggtcatgtgtttgattcattctttgtttaattttagagagtatggtgttatatggtttagaggatttgatgtatccaactttatggttacaaaattgtgg |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34370751 |
ggtcatgtgtttgat-cattctttgtttaattttagagagtatggtgttatatggtttagaggatttgatgtatccaactttatggttacaaaattgtgg |
34370653 |
T |
 |
| Q |
239 |
gttatgttaatgttatatatacatgatttagttgtcttggctcctatg |
286 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
34370652 |
gttatgttaatgtta--tatacatgatttagttgtcttggctcttatg |
34370607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 34370898 - 34370826
Alignment:
| Q |
1 |
gcataataacaagaacacttttgccaagagaaatctttctacaagctagatataatgtagaataaggtcctaa |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34370898 |
gcataataacaagaacacttttgccaagagaaatctttctacaagctagatataatgtagaatgaggtcctaa |
34370826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University